Review



q5 hot start high fidelity 2× master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs q5 hot start high fidelity 2× master mix
    Q5 Hot Start High Fidelity 2× Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2534 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Q5+Hot+Start+High-Fidelity+Master+Mix/pmc12811532-48-30-37
    Average 99 stars, based on 2534 article reviews
    q5 hot start high fidelity 2× master mix - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Functional screening with optimized functional CRISPR-Cas systems
    Article Snippet: Genomic DNA was extracted using the Zymo Quick-gDNA midi kit (Zymo Research). .. PCR of the virally integrated guides was performed on gDNA at the equivalent of >500 cells/guide in 96 parallel reactions using NEBnext High Fidelity 2× Master Mix (New England Biolabs) in a single-step reaction of 22 cycles. .. Primers are listed below: forward primer: (SEQ ID NO: 128) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT TCCGATCTNNNNNNNN(1-10bp stagger)GCTTTATATATCTTGTGG AAAGGACGAAACACC 8 bp barcode indicated in red reverse primer: (SEQ ID NO: 129) CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACG TGTGCTC TTCCGATCTGCCAAGTTGATAACGGACTAGCCTT 8 bp index read barcode indicated in red PCR products from all 96 reactions were pooled, purified using Zymo-SpinTM V with Reservoir (Zymo research) and gel extracted using the ZymocleanTM Gel DNA Recovery Kit (Zymo research).

    Article Title: Adenine base editor correction of pathogenic variations associated with inherited retinal dystrophy in patient iPSC and retinal organoids
    Article Snippet: Universal tagged primers for MiSeq (Illumina) high-throughput sequencing (HTS) are listed in . .. PCR amplification was carried out using High-Fidelity 2× Master Mix (NEB). .. Products were gel-extracted (Monarch DNA Gel Extraction Kit, NEB), and 300–500 ng of product was used for subsequent steps.

    Article Title: High frequency of fungicide resistance-associated mutations in the wheat yellow rust pathogen Puccinia striiformis f. sp. tritici.
    Article Snippet: 2.4 Cloning of Cyp51 alleles from New Zealand Pst isolates containing the Y134F substitution DNA was extracted from Pst-infected leaves for three New Zealand Pst isolates, 06/01, 09/01 and 12/09 that were heterokaryotic for the Y134F substitution, using the Qiagen DNeasy Plant Kit (Qiagen) according to the manufacturer's instructions. .. The Cyp51 gene was polymerase chain reaction (PCR) amplified from the resulting DNA using Q5@® High-Fidelity 2× Master Mix (New England Biolabs) and primers PST_Cyp51_Promoter_F and PST_Cyp51_Amp5.2 with 35 cycles (Table 1). .. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) following the manufacturer's instructions.

    Article Title: In Vivo Genome-Wide CRISPR Activation Screening Identifies Functionally Important Long Noncoding RNAs in Hepatocellular Carcinoma
    Article Snippet: The lysate mixture was incubated with RNaseA (Life Technologies), 7.5 mol/L ammonium acetate, isopropanol, and ethanol for genomic DNA precipitation. .. Before deep-sequencing analysis, sgRNA regions were amplified from genomic DNA using NEBnext High Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA) with 24 cycles of PCR reactions. ..

    Article Title: Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems
    Article Snippet: Genomic DNA was extracted using the Zymo Quick-gDNA midi kit (Zymo Research). .. PCR of the virally integrated guides was performed on gDNA at the equivalent of >500 cells/guide in 96 parallel reactions using NEBnext High Fidelity 2× Master Mix (New England Biolabs) in a single-step reaction of 22 cycles. .. Primers are listed below: forward primer: (SEQ ID NO: 223) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT CCGATCTNNNNNNNN(1-10 bp stagger)GCTTTATATATCTTGTGG AAAGGACGAAACACC 8 bp Barcode Indicated in Red reverse primer: (SEQ ID NO: 224) CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGAC GTGTGCTCTTCCGATCTGCCAAGTTGATAACGGACTAGCCTT 8 bp Index Read Barcode Indicated in Red PCR products from all 96 reactions were pooled, purified using Zymo-SpinTM V with Reservoir (Zymo research) and gel extracted using the ZymocleanTM Gel DNA Recovery Kit (Zymo research).

    Amplification:

    Article Title: Adenine base editor correction of pathogenic variations associated with inherited retinal dystrophy in patient iPSC and retinal organoids
    Article Snippet: Universal tagged primers for MiSeq (Illumina) high-throughput sequencing (HTS) are listed in . .. PCR amplification was carried out using High-Fidelity 2× Master Mix (NEB). .. Products were gel-extracted (Monarch DNA Gel Extraction Kit, NEB), and 300–500 ng of product was used for subsequent steps.

    Article Title: High frequency of fungicide resistance-associated mutations in the wheat yellow rust pathogen Puccinia striiformis f. sp. tritici.
    Article Snippet: 2.4 Cloning of Cyp51 alleles from New Zealand Pst isolates containing the Y134F substitution DNA was extracted from Pst-infected leaves for three New Zealand Pst isolates, 06/01, 09/01 and 12/09 that were heterokaryotic for the Y134F substitution, using the Qiagen DNeasy Plant Kit (Qiagen) according to the manufacturer's instructions. .. The Cyp51 gene was polymerase chain reaction (PCR) amplified from the resulting DNA using Q5@® High-Fidelity 2× Master Mix (New England Biolabs) and primers PST_Cyp51_Promoter_F and PST_Cyp51_Amp5.2 with 35 cycles (Table 1). .. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) following the manufacturer's instructions.

    Article Title: In Vivo Genome-Wide CRISPR Activation Screening Identifies Functionally Important Long Noncoding RNAs in Hepatocellular Carcinoma
    Article Snippet: The lysate mixture was incubated with RNaseA (Life Technologies), 7.5 mol/L ammonium acetate, isopropanol, and ethanol for genomic DNA precipitation. .. Before deep-sequencing analysis, sgRNA regions were amplified from genomic DNA using NEBnext High Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA) with 24 cycles of PCR reactions. ..



    Similar Products

    99
    New England Biolabs q5 hot start high fidelity 2× master mix
    Q5 Hot Start High Fidelity 2× Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Q5+Hot+Start+High-Fidelity+Master+Mix/pmc12811532-48-30-37
    Average 99 stars, based on 1 article reviews
    q5 hot start high fidelity 2× master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    97
    Vazyme Biotech Co high fidelity 2 × phanta max master mix
    High Fidelity 2 × Phanta Max Master Mix, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Phanta+Max+Master+Mix/pmc12907642-83-8-16
    Average 97 stars, based on 1 article reviews
    high fidelity 2 × phanta max master mix - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 high fidelity 2 × master mix
    Q5 High Fidelity 2 × Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Q5+High-Fidelity+Master+Mix/pmc13089080-319-27-33
    Average 99 stars, based on 1 article reviews
    q5 high fidelity 2 × master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs nebnext high fidelity 2 × pcr master mix
    Nebnext High Fidelity 2 × Pcr Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/NEBNext+High-Fidelity+PCR+Master+Mix/pmc13153709-102-16-24
    Average 99 stars, based on 1 article reviews
    nebnext high fidelity 2 × pcr master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 high fidelity 2× master mix
    Q5 High Fidelity 2× Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Q5+High-Fidelity+Master+Mix/pmc13174089-116-16-21
    Average 99 stars, based on 1 article reviews
    q5 high fidelity 2× master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 2× master mix
    Q5 2× Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Q5+High-Fidelity+Master+Mix/bio_rxiv__64898__2026__05__06__723292-213-29-33
    Average 99 stars, based on 1 article reviews
    q5 2× master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 high fidelity 2 x master mix
    Q5 High Fidelity 2 X Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+fidelity+2%C3%97+master+mix/Q5+High-Fidelity+Master+Mix/pm42086580-183-21-28
    Average 99 stars, based on 1 article reviews
    q5 high fidelity 2 x master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results